Exploring antithrombin: insights into its physiological features, clinical implications and analytical techniques.

Antithrombin is an essential protein that acts as a natural anticoagulant in the human body. It is synthesized by the liver and belongs to the serine protease inhibitors, which are commonly referred to as the SERPINS superfamily. The antithrombin molecule comprises 432 amino acids and has a molecular weight of approximately 58 200 D. It consists of three domains, including an amino-terminal domain, a carbohydrate-rich domain, and a carboxyl-terminal domain. The amino-terminal domain binds with heparin, whereas the carboxyl-terminal domain binds with serine protease. Antithrombin is a crucial natural anticoagulant that contributes approximately 60-80% of plasma anticoagulant activities in the human body. Moreover, antithrombin has anti-inflammatory effects that can be divided into coagulation-dependent and coagulation-independent effects. Furthermore, it exhibits antitumor activity and possesses a broad range of antiviral properties. Inherited type I antithrombin deficiency is a quantitative disorder that is characterized by low antithrombin activity due to low plasma levels. On the other hand, inherited type II antithrombin deficiency is a qualitative disorder that is characterized by defects in the antithrombin molecule. Acquired antithrombin deficiencies are more common than hereditary deficiencies and are associated with various clinical conditions due to reduced synthesis, increased loss, or enhanced consumption. The purpose of this review was to provide an update on the structure, functions, clinical implications, and methods of detection of antithrombin.

The Homozygous Type II Antithrombin Deficient Pregnant Woman Monitored by Thrombin Generation Assay.

BACKGROUND: We present the case study of a 28-year-old pregnant woman with antithrombin deficiency who was treated with low-molecular-weight heparin (LMWH). METHODS: Due to severe homozygous type II antithrombin heparin binding site (HBS) deficiency, the thrombin generation (TG) was monitored in this woman via the Thrombin Generation Assay (TGA). We used Siemens diagnostic kits Berichrom® Antithrombin III (IIa) and INNOVANCE® Antithrombin (Xa) to determine antithrombin activity. We used a chromogenic method for determination of factor Xa (FXa) inhibition. RESULTS: There were no thrombotic complications during the whole pregnancy of the observed woman. Antithrombin was administered before and after delivery, which was significantly reflected in the decrease in thrombin generation. CONCLUSIONS: Consistent monitoring of thrombin generation with LMWH anticoagulant therapy administration during pregnancy together with antithrombin administration before and after delivery can improve the overall condition of pregnant women and the quality of their care.

Antithrombin Therapy: Current State and Future Outlook.

Antithrombin (AT) is a natural anticoagulant pivotal in inactivating serine protease enzymes in the coagulation cascade, making it a potent inhibitor of blood clot formation. AT also possesses anti-inflammatory properties by influencing anticoagulation and directly interacting with endothelial cells. Hereditary AT deficiency is one of the most severe inherited thrombophilias, with up to 85% lifetime risk of venous thromboembolism. Acquired AT deficiency arises during heparin therapy or states of hypercoagulability like sepsis and premature infancy. Optimization of AT levels in individuals with AT deficiency is an important treatment consideration, particularly during high-risk situations such as surgery, trauma, pregnancy, and postpartum. Here, we integrate the existing evidence surrounding the approved uses of AT therapy, as well as potential additional patient populations where AT therapy has been considered by the medical community, including any available consensus statements and guidelines. We also describe current knowledge regarding cost-effectiveness of AT concentrate in different contexts. Future work should seek to identify specific patient populations for whom targeted AT therapy is likely to provide the strongest clinical benefit.

Thrombin Generation Decrease After LMWH Administration in an Antithrombin-Deficient Pregnant Woman With a Homozygous HBS II Mutation.

The cases of antithrombin (AT)-deficient pregnant women with a homozygous HBS II mutation are relatively rare and are accompanied by an increased thrombophilic risk, which is manifested by increased thrombin generation (TG). It is very difficult to ensure their prophylactic treatment during pregnancy. We aimed to determine the utility of the thrombin generation assay (TGA) and anti-factor Xa (anti-FXa) test to monitor the effects of a prophylactic dose of low-molecular-weight heparin (LMWH) in a 28-year-old woman with homozygous AT deficiency caused by mutation c.391C > T#, (p.Leu131Phe†) in the SERPINC1 gene and to compare the findings with those from a group of pregnant and non-pregnant women also treated with LMWH. TG monitoring was chosen due to severe AT deficiency that was manifested by low levels of anti-FXa activity when monitoring the efficacy of LMWH treatment. A significant decrease in TG was detected in all monitored groups (P < .05). There were no thrombotic complications during the whole pregnancy of the woman with AT deficiency. Consistent monitoring of TG with LMWH anticoagulant therapy administration during pregnancy together with AT administration before and after delivery may improve the overall condition of pregnant women and the quality of their care.

Peripartum management of deep venous thrombosis in the context of antithrombin deficiency and May-Thurner syndrome.

Literature regarding the management of thrombus refractory to first-line treatment in the setting of pregnancy is limited, and management is made even more complicated in the context of thrombophilia. This case reviews the management of a patient with antithrombin deficiency who developed a massive thrombus during pregnancy, which was complicated by May-Thurner syndrome, lack of improvement with heparin, and preterm labor. The patient received multidisciplinary care throughout the pregnancy. At 35 weeks, anticoagulation was paused as she underwent induction of labor and delivery followed by postpartum placement of inferior vena cava filter and restarting heparin. Successful management of our pregnant patient with thrombus refractory to heparin hinged on individualized treatment for medical optimization with anticoagulation and antithrombin concentrate prior to labor followed by immediate postpartum placement of inferior vena cava filter.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Management of Antithrombin Deficiency in Pregnancy.

Antithrombin (AT) deficiency is a high-risk thrombophilia and a rare condition. The risk of venous thromboembolism (VTE) is increased in AT-deficient women during pregnancy and the postpartum period and is especially high in women with a prior history of VTE. A thorough assessment of VTE risk is recommended in pregnant AT-deficient women, comprising the degree and type of AT deficiency, genetic mutations, personal and family history, and additional preexisting or pregnancy-specific risk factors. Due to a lack of adequate study data, there is limited guidance on the management of AT deficiency in pregnancy, including the need for prophylactic anticoagulation, the appropriate dose of low-molecular-weight heparin (LMWH), and the role of AT substitution. LMWH is the medication of choice for the pharmacological prophylaxis and treatment of VTE in pregnancy. Patients with a history of VTE should receive full-dose LMWH during pregnancy and the postpartum period. AT concentrates are a treatment option when anticoagulation is withheld in potentially high-risk events such as childbirth, bleeding, or surgery and in cases of acute VTE despite the use of therapeutic dose anticoagulation. Women with AT deficiency should be counseled at specialized centers for coagulation disorders or vascular medicine, and close cooperation between obstetricians and anesthesiologists is warranted before delivery and during the peripartum period.

Prevention of venous thromboembolism in pregnant women with congenital antithrombin deficiency: a retrospective study of a candidate protocol.

BACKGROUND: The best thromboprophylaxis for pregnant women with congenital antithrombin deficiency (CAD) is controversial. OBJECTIVE: To clarify the effectiveness of a protocol for venous thromboembolism (VTE) prevention in pregnant women with CAD. METHODS: Women at high risk of VTE were administered antithrombin concentrate and heparin after conception, whereas those at low risk of VTE were administered heparin alone until delivery. All women received antithrombin concentrate at delivery except for one who was diagnosed with CAD. RESULTS: Ten women had CAD, including one in the high-risk group and nine in the low-risk group. No women had VTE at delivery as per the protocol for VTE prevention. Almost all women had increased antithrombin activity before delivery followed by maintenance at ≥ 70% due to antithrombin concentrate administration. VTE prophylaxis during and after delivery was successful in all women with CAD. However, one woman in the low-risk group did not receive heparin and developed VTE induced by severe hyperemesis at 9 gestational weeks, before the diagnosis of CAD. Women in the high-risk group received antithrombin concentrate after delivery but had increased D-dimer levels at postpartum. CONCLUSIONS: Our protocol to prevent VTE in pregnant women with CAD is safe and effective.

Management of heparin resistance due to antithrombin deficiency in a Chinese pregnant woman: a case report.

Untreated individuals with antithrombin (AT) deficiency are at higher risk of thrombosis and adverse pregnancy outcomes. The present recommendations are mostly empirical for treating patients with AT deficiency during pregnancy because of the absence of guidelines. We report a rare case of heparin resistance due to AT deficiency in a pregnant 32-year-old Chinese woman. We also reviewed the English medical literature for AT deficiency and its association with thromboembolism and treatment. This patient suffered two early miscarriages because of thrombosis due to AT deficiency. The patient was administered the combination of adequate low molecular weight heparin with fresh frozen plasma and warfarin because of her heparin resistance. She delivered a healthy female newborn without any adverse effects of the anticoagulation therapy. Our findings suggest that the combination of adequate low molecular weight heparin with fresh frozen plasma and warfarin is effective for preventing thrombus during pregnancy.

Antithrombin Deficiency in Trauma and Surgical Critical Care.

Antithrombin deficiency (ATD) was described in 1965 by Olav Egeberg as the first known inherited form of thrombophilia. Today, it is understood that ATDs can be congenital or acquired, leading to qualitative, quantitative, or mixed abnormalities in antithrombin (AT). All ATDs ultimately hinder AT's ability to serve as an endogenous anticoagulant and antiinflammatory agent. As a result, ATD patients possess higher risk for thromboembolism and can develop recurrent venous and arterial thromboses. Because heparin relies on AT to augment its physiologic function, patients with ATD often exhibit profound heparin resistance. Although rare as a genetic disorder, acquired forms of ATD are seen with surprising frequency in critically ill patients. This review discusses ATD in the context of surgical critical care with specific relevance to trauma, thermal burns, cardiothoracic surgery, and sepsis.

Successful administration of recombinant human antithrombin in a pregnant Japanese woman with hereditary antithrombin deficiency.

OBJECTIVE: Hereditary antithrombin (AT) deficiency increases the risk of venous thromboembolism (VTE) in pregnant woman. We report the first case of administration of recombinant human antithrombin (rhAT) to a pregnant Japanese woman with AT deficiency. CASE REPORT: A 30-year-old woman, gravida 2 para 0, was referred to our hospital because of AT deficiency. Unfractionated heparin was administered from 13 weeks of gestation and rhAT was administered from labor onset. A cesarean section was performed and the patient and her baby were healthy, with no sequelae. CONCLUSION: We concluded that rhAT was effective for preventing VTE during delivery, with no potential infection risks.

Antithrombin concentrate during pregnancy in congenital antithrombin deficiency: a single-center experience.

: Pregnancy carries a high risk of thromboembolic complications, especially in the postpartum period. This risk is particularly high in women with inherited thrombophilias, among these antithrombin deficiency seems to carry the highest risk. In this case, the use of low molecular weight heparin (LMWH) is recommended, while the use of antithrombin concentrate is controversial. We report our experience of seven pregnancies occurred in five women: two, with a personal and familiar history negative for venous thromboembolism, were treated with LMWH during pregnancy and antithrombin concentrate immediately before and after the delivery. The other three women had a personal and familiar history positive for venous thromboembolism and were treated with LMWH and antithrombin concentrate during all the pregnancy and the postpartum period. No thromboembolic or hemorrhagic complications were observed in both groups, demonstrating that our strategy could be safe and effective.

Management of antithrombin deficiency: an update for clinicians.

Introduction. Antithrombin is a serpin that inhibits multiple procoagulant serine proteases and acts as an endogenous anticoagulant. Thus, congenital antithrombin deficiency constitutes a major thrombophilic state, the most severe so far. Areas covered. In the present work, we globally review the biology, genetics, diagnosis, and management of congenital antithrombin deficiency, and also discuss puzzling questions and future perspectives regarding this severe inherited thrombophilia. Expert opinion. Although this disorder exerts high clinical heterogeneity, many carriers will need careful and long-term anticoagulation and/or thromboprophylaxis, especially in high-risk situations, such as surgery and pregnancy. Notably, antithrombin concentrates constitute a considerable arsenal for both treatment and prevention of acute venous thrombosis in subjects with antithrombin deficiency. Current evidences are based almost exclusively on retrospective case series, so an integrated functional, biochemical and molecular characterization will be of clinical relevance and guide hematologists' personalized decisions.

Capped antithrombin III dosing is cost effective in the management of asparaginase-associated thrombosis.

Asparaginase therapy induces a transient antithrombin III (ATIII) deficiency, which contributes to the risk of asparaginase-induced thrombosis. At Cincinnati Children's Hospital Medical Center, management of asparaginase-induced thrombosis includes ATIII supplementation during therapeutic anticoagulation with enoxaparin. Due to the expense associated with ATIII, a capped dosing approach for ATIII was evaluated in this population. Peak ATIII levels were obtained following capped doses to evaluate response. In this pilot evaluation, 11 patients received a total of 138 capped doses for a total cost savings of $803 782. This pilot evaluation represents the first reported analysis of capped ATIII dosing in oncology patients.

Monitoring of heparins in antithrombin-deficient patients.

INTRODUCTION: Heparins exert their anticoagulant effect through activation of antithrombin. Whether antithrombin deficiency leads to clinically relevantly reduced anti-Xa activity of heparins is unknown. We investigated the relation between antithrombin deficiency and anti-Xa activity measurements of plasma samples spiked with unfractionated heparin (UFH) or low-molecular-weight heparin (LMWH). MATERIALS AND METHODS: Plasma samples from 34 antithrombin-deficient subjects and 17 family controls were spiked with UFH and LMWH (nadroparin) aimed to correspond with an anti-Xa activity of 0.8 IU/mL. Antithrombin, ß-antithrombin and anti-Xa activities were measured. RESULTS: Mean anti-Xa activity with LWMH was 0.55 IU/mL (0.30-0.74) (recovery 69%, 38-93%) in antithrombin-deficient subjects and 0.82 (0.71-0.89) IU/mL in controls (recovery 103%, 89-111%). Expected anti-Xa measurements after LMWH spiking were found in 17/17 non-deficient subjects and in 8/34 antithrombin-deficient subjects. Anti-Xa measurements in the expected range (0.6-1.0 IU/mL) after UFH spiking were found in 17/17 non-deficient subjects and in 1/22 antithrombin-deficient subjects. Antithrombin activity correlated with anti-Xa activity of UFH (R = 0.77) and LMWH (R = 0.66). Mixing studies of pooled normal plasma and antithrombin-deficient plasma showed that anti-Xa recovery was linearly reduced with antithrombin activity decreasing below 100%. CONCLUSIONS: Reduced antithrombin activity causes significantly reduced anti-Xa levels. Standard LWMH- or UFH-doses are likely to lead to under treatment in antithrombin-deficient individuals.

Double-Blind, Randomized, Placebo-Controlled Trial Comparing the Effects of Antithrombin Versus Placebo on the Coagulation System in Infants with Low Antithrombin Undergoing Congenital Cardiac Surgery.

OBJECTIVES: To determine whether precardiopulmonary bypass (CPB) normalization of antithrombin levels in infants to 100% improves heparin sensitivity and anticoagulation during CPB and has beneficial effects into the postoperative period. DESIGN: Randomized, double-blinded, placebo-controlled prospective study. SETTING: Multicenter study performed in 2 academic hospitals. PARTICIPANTS: The study comprised 40 infants younger than 7 months with preoperative antithrombin levels <70% undergoing CPB surgery. INTERVENTIONS: Antithrombin levels were increased with exogenous antithrombin to 100% functional level intraoperatively before surgical incision. MEASUREMENTS AND MAIN RESULTS: Demographics, clinical variables, and blood samples were collected up to postoperative day 4. Higher first post-heparin activated clotting times (sec) were observed in the antithrombin group despite similar initial heparin dosing. There was an increase in heparin sensitivity in the antithrombin group. There was significantly lower 24-hour chest tube output (mL/kg) in the antithrombin group and lower overall blood product unit exposures in the antithrombin group as a whole. Functional antithrombin levels (%) were significantly higher in the treatment group versus placebo group until postoperative day 2. D-dimer was significantly lower in the antithrombin group than in the placebo group on postoperative day 4. CONCLUSION: Supplementation of antithrombin in infants with low antithrombin levels improves heparin sensitivity and anticoagulation during CPB without increased rates of bleeding or adverse events. Beneficial effects may be seen into the postoperative period, reflected by significantly less postoperative bleeding and exposure to blood products and reduced generation of D-dimers.

Overcoming heparin resistance in pregnant women with antithrombin deficiency: a case report and review of the literature.

BACKGROUND: The risk of thromboembolic events during pregnancy in patients with antithrombin deficiency is increased. Preventing thromboembolic events during pregnancy in the case of antithrombin deficiency is still a matter of concern. CASE PRESENTATION: We present a case of a 19-year-old primigravida Greek Pomak woman, who was diagnosed as having congenital antithrombin deficiency. She had a history of recurrent miscarriages and a family history of thrombosis. She was managed with adjusted doses of low molecular weight heparin throughout her pregnancy, with regular anti-Xa and antithrombin level monitoring. Prior to delivery and for 4 days after delivery she received human antithrombin III concentrate. She delivered a small for gestational age baby with no other complications. She required an increased dose of heparin due to heparin resistance. CONCLUSIONS: Antithrombin deficiency is associated with an increased risk of venous thromboembolic events with a 50% risk of thromboembolic events before the 50th year of life. It is a rare condition, so data concerning the optimal management during pregnancy are limited. The selection of patients who should receive low molecular weight heparin prophylaxis as well as dose intensity and monitoring are discussed. In our patient a conventional low molecular weight heparin dose proved to be inadequate at least at the laboratory level.

Revisiting antithrombin in health and disease, congenital deficiencies and genetic variants, and laboratory studies on α and ß forms.

Antithrombin [AT] is the main inhibitor for activated plasma coagulation serine esterases, inhibiting thrombin, Factors Xa and IXa, but also Factors XIIa, XIa, VIIa, kallicrein, and plasmin. Its activity is highly enhanced by heparin, through binding to the pentasaccharide sequences, for inhibition of all coagulation proteases, except thrombin, which inhibition requires its additional binding to the heparin polysaccharide chain. However, AT is the major inhibitor of thrombin in the blood circulation. Congenital or acquired deficiencies of AT expose affected patients to an increased risk of developing unprovoked and recurrent thrombo-embolic diseases. Antithrombin can be measured with various laboratory techniques, by either immunological or functional methods. Earlier, a radial immunodiffusion immunoassay allowed measurement of the protein antigenic content. Functional assays are mainly designed with Anti-Thrombin or Anti-Factor Xa chromogenic methods and are useful for detecting genetic molecular mutations with decreased inhibitory activity and contributed to study the conformational changes of antithrombin and its variants, which potentially regulate the activity of this serine protease inhibitor. These assays are not equivalent in terms of diagnosing protein abnormalities, associated with increased thrombotic incidence, and they have variable performance for reflecting impaired antithrombin binding capacity for heparin, reduced progressive inhibition of serine proteases, or accelerated switch rates to the latent and less active forms. A small proportion of AT (<10%) is present in blood in the ß-form, with a lower oligosaccharide content, a lower Molecular Weight, a higher binding rate to endothelial glycosaminoglycans, and a higher anticoagulant activity, hence requiring specific laboratory methods for its measurement. The ß-AT form is then of critical importance for controlling blood activation by tissue injury and preventing development of thrombo-embolic diseases. This article reviews the performance characteristics of the currently available assays, and their usefulness for monitoring the use of AT concentrates in intensive care units, disseminated intravascular coagulation or severe infections, to restore the anticoagulant protective effect of heparin by supplementing the requested AT concentration. The issues of automation, harmonization and standardization are also revisited and discussed.